ID: 989799181_989799186

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989799181 989799186
Species Human (GRCh38) Human (GRCh38)
Location 5:45514702-45514724 5:45514743-45514765
Sequence CCTACAGAGGAAACCTTTTCAAT CACATTTGGCAAATGTTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 427} {0: 1, 1: 0, 2: 0, 3: 21, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!