|
Left Crispr |
Right Crispr |
| Crispr ID |
989805392 |
989805398 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:45597565-45597587
|
5:45597596-45597618
|
| Sequence |
CCAGGGCAATCAGGCAAGAGAAG |
GGGGATTCAATTAGGAAAACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 135, 1: 5628, 2: 9345, 3: 6039, 4: 4541} |
{0: 2, 1: 131, 2: 7924, 3: 3776, 4: 2473} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|