ID: 989807266_989807270

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 989807266 989807270
Species Human (GRCh38) Human (GRCh38)
Location 5:45624740-45624762 5:45624768-45624790
Sequence CCATTTGGGAATGAGAAACATCT CCTGGGCCCTCTTGTGTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 285} {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!