ID: 989807660_989807666

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 989807660 989807666
Species Human (GRCh38) Human (GRCh38)
Location 5:45630201-45630223 5:45630243-45630265
Sequence CCTGCCTCTTTTCCAAAACTAGT ATTTAAGCAGAGAGGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 279} {0: 1, 1: 0, 2: 2, 3: 28, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!