ID: 989960652_989960655

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 989960652 989960655
Species Human (GRCh38) Human (GRCh38)
Location 5:50410644-50410666 5:50410671-50410693
Sequence CCTTTTGAACTAAAACATGTGCT ATTGAGGAATAGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 195} {0: 2, 1: 0, 2: 2, 3: 38, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!