ID: 989977757_989977763

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989977757 989977763
Species Human (GRCh38) Human (GRCh38)
Location 5:50607354-50607376 5:50607395-50607417
Sequence CCCTAAAGGAAAAGACAAATTAA CTGTTAACAAAGAAGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 4, 3: 48, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!