ID: 989987014_989987017

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 989987014 989987017
Species Human (GRCh38) Human (GRCh38)
Location 5:50713108-50713130 5:50713136-50713158
Sequence CCCCATTTATAAAATGGCTGTGA ATCTATATGTTATAGATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 130, 4: 1067} {0: 1, 1: 0, 2: 2, 3: 15, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!