ID: 990115552_990115564

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 990115552 990115564
Species Human (GRCh38) Human (GRCh38)
Location 5:52385969-52385991 5:52386019-52386041
Sequence CCGGTCTTCTTGTCCCCCAGCTA CTGGAAAGAAGGAGAATAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 215} {0: 1, 1: 0, 2: 1, 3: 37, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!