ID: 990119922_990119927

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 990119922 990119927
Species Human (GRCh38) Human (GRCh38)
Location 5:52438540-52438562 5:52438581-52438603
Sequence CCTGGGGAACTCTAGCAAATTGA AAGGTGCAAAAAAAAAAATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 153, 4: 1500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!