ID: 990130699_990130705

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 990130699 990130705
Species Human (GRCh38) Human (GRCh38)
Location 5:52579573-52579595 5:52579600-52579622
Sequence CCCGGTTTCTGACAAGTGCCTCA GGAGTTGCCAGTATTAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 157} {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!