ID: 990155031_990155036

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 990155031 990155036
Species Human (GRCh38) Human (GRCh38)
Location 5:52867289-52867311 5:52867329-52867351
Sequence CCAAGGCTGAATAGGTCTCTGTA TAAGGTTATAAATATCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103} {0: 1, 1: 0, 2: 2, 3: 11, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!