ID: 990168190_990168202

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 990168190 990168202
Species Human (GRCh38) Human (GRCh38)
Location 5:53018145-53018167 5:53018197-53018219
Sequence CCCACGGGCAAGACTGCCCTGCT TAAAGTCTCCTATAGGAGCACGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 14, 3: 44, 4: 133} {0: 1, 1: 3, 2: 30, 3: 40, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!