ID: 990210746_990210754

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 990210746 990210754
Species Human (GRCh38) Human (GRCh38)
Location 5:53480040-53480062 5:53480077-53480099
Sequence CCCGGGGCGGGATATTTGGGCAG GCCGTTTGCAAAAGTCTCTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!