ID: 990257947_990257958

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 990257947 990257958
Species Human (GRCh38) Human (GRCh38)
Location 5:53991039-53991061 5:53991090-53991112
Sequence CCTACCCCCACCCCATGGGTATA GATAACTGAATTGAATGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 344} {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!