ID: 990265677_990265679

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 990265677 990265679
Species Human (GRCh38) Human (GRCh38)
Location 5:54072350-54072372 5:54072370-54072392
Sequence CCTAATTGCAGCTGTGGATAAAC AACACAAACAAGGACACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!