ID: 990308645_990308649

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 990308645 990308649
Species Human (GRCh38) Human (GRCh38)
Location 5:54517930-54517952 5:54517948-54517970
Sequence CCGCCAGTCGGGGCGCCGGGACC GGACCATGGCGCTGCGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97} {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!