ID: 990308646_990308650

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 990308646 990308650
Species Human (GRCh38) Human (GRCh38)
Location 5:54517933-54517955 5:54517949-54517971
Sequence CCAGTCGGGGCGCCGGGACCATG GACCATGGCGCTGCGCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!