ID: 990322050_990322056

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 990322050 990322056
Species Human (GRCh38) Human (GRCh38)
Location 5:54639810-54639832 5:54639834-54639856
Sequence CCTCCTGGGGTTAAGTGATTAGG TGACCAAGGAGGTTATGCAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!