ID: 990342296_990342301

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 990342296 990342301
Species Human (GRCh38) Human (GRCh38)
Location 5:54835383-54835405 5:54835408-54835430
Sequence CCTACCTAAATCTATATCCATAG TAACTGCCTAATAAAGGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!