ID: 990358227_990358233

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 990358227 990358233
Species Human (GRCh38) Human (GRCh38)
Location 5:54991675-54991697 5:54991717-54991739
Sequence CCTGCATGAGAGTGTCCTGGGAA GCCAGGGATTCCAATCTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!