ID: 990371385_990371393

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 990371385 990371393
Species Human (GRCh38) Human (GRCh38)
Location 5:55122522-55122544 5:55122557-55122579
Sequence CCTCGCCCATTCCCTCCATCAAT ATTCCTCTACCTTTGAATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193} {0: 1, 1: 1, 2: 13, 3: 90, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!