ID: 990371385_990371396

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 990371385 990371396
Species Human (GRCh38) Human (GRCh38)
Location 5:55122522-55122544 5:55122574-55122596
Sequence CCTCGCCCATTCCCTCCATCAAT TGTGGGACTTGTGACTATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193} {0: 1, 1: 0, 2: 2, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!