ID: 990375427_990375430

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 990375427 990375430
Species Human (GRCh38) Human (GRCh38)
Location 5:55165852-55165874 5:55165887-55165909
Sequence CCCTTTGCAACTCTAAAAGTCAA CTAAGGTGTTTTAAGTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 278} {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!