ID: 990409513_990409523

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 990409513 990409523
Species Human (GRCh38) Human (GRCh38)
Location 5:55527179-55527201 5:55527223-55527245
Sequence CCCCTTTGAGGAAGGGACCCAGA GCTCCTTAGGAGTATCCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 258} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!