ID: 990428089_990428091

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 990428089 990428091
Species Human (GRCh38) Human (GRCh38)
Location 5:55708852-55708874 5:55708878-55708900
Sequence CCAATAGAACTTTATGAAAAAAA ATCTGTCAGCAGGCCAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 193, 4: 2505} {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!