ID: 990438690_990438704

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 990438690 990438704
Species Human (GRCh38) Human (GRCh38)
Location 5:55821906-55821928 5:55821957-55821979
Sequence CCGAGCTCGCGGAGGCGGGCTTC ACGCTCTCCCAGCCAGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 44} {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!