ID: 990482974_990482975

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 990482974 990482975
Species Human (GRCh38) Human (GRCh38)
Location 5:56229532-56229554 5:56229551-56229573
Sequence CCAGTGGAGATCAACTAGTTTGT TTGTGCAAGTTCATGTAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 77} {0: 1, 1: 0, 2: 1, 3: 23, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!