|
Left Crispr |
Right Crispr |
| Crispr ID |
990575405 |
990575407 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:57119084-57119106
|
5:57119100-57119122
|
| Sequence |
CCTCAGAACCAGGACAGGTTCAG |
GGTTCAGAGAGCTCCCTCAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 9, 2: 44, 3: 121, 4: 468} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|