ID: 990669523_990669526

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 990669523 990669526
Species Human (GRCh38) Human (GRCh38)
Location 5:58112543-58112565 5:58112558-58112580
Sequence CCCCAAGCTGAGACAACTAAAAA ACTAAAAATGTCTCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 16, 3: 144, 4: 629} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!