ID: 990696106_990696112

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 990696106 990696112
Species Human (GRCh38) Human (GRCh38)
Location 5:58419515-58419537 5:58419547-58419569
Sequence CCCAAGAACCTAGACTAAGGTAA ATGGAAGAAGCTTGGGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!