ID: 990716206_990716208

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 990716206 990716208
Species Human (GRCh38) Human (GRCh38)
Location 5:58639957-58639979 5:58639996-58640018
Sequence CCATTCTCTTTCTTTATCCACAG AATGATTTTTTAAATGTACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 58, 4: 653} {0: 1, 1: 0, 2: 12, 3: 96, 4: 826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!