ID: 990729226_990729228

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 990729226 990729228
Species Human (GRCh38) Human (GRCh38)
Location 5:58790120-58790142 5:58790134-58790156
Sequence CCCATAGGCATCTCAAACTCAGC AAACTCAGCATGTCCAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 35, 3: 97, 4: 364} {0: 1, 1: 2, 2: 13, 3: 40, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!