ID: 990777021_990777025

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 990777021 990777025
Species Human (GRCh38) Human (GRCh38)
Location 5:59314323-59314345 5:59314358-59314380
Sequence CCATCTATAACATTACAAATTCT GCTCTTGGCCTTATAATGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 372} {0: 1, 1: 0, 2: 1, 3: 3, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!