|
Left Crispr |
Right Crispr |
| Crispr ID |
990786411 |
990786415 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:59425481-59425503
|
5:59425498-59425520
|
| Sequence |
CCTAGACATTGCCAAATGTCCCC |
GTCCCCTGCATGAGAGGTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 50, 2: 185, 3: 180, 4: 305} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|