ID: 990795982_990795988

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 990795982 990795988
Species Human (GRCh38) Human (GRCh38)
Location 5:59541582-59541604 5:59541628-59541650
Sequence CCTCCCCCTTTATATAGGGAATA ATAATTGTGCAGAAAGCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161} {0: 1, 1: 0, 2: 4, 3: 39, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!