ID: 990849139_990849144

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 990849139 990849144
Species Human (GRCh38) Human (GRCh38)
Location 5:60181966-60181988 5:60181995-60182017
Sequence CCTGATTAGCTAAAAGCCAGTAA AGGCATTAGCAGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101} {0: 1, 1: 0, 2: 3, 3: 40, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!