ID: 990875140_990875142

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 990875140 990875142
Species Human (GRCh38) Human (GRCh38)
Location 5:60475855-60475877 5:60475883-60475905
Sequence CCGCATCACATAGCGTTGCAGGG TGAGTGAAATGTCATATAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110} {0: 1, 1: 0, 2: 1, 3: 12, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!