ID: 990877291_990877293

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 990877291 990877293
Species Human (GRCh38) Human (GRCh38)
Location 5:60500023-60500045 5:60500046-60500068
Sequence CCCAGGCTGGGTGTGGTGGCTCA TACCTCTAATCCCAGCACTTAGG
Strand - +
Off-target summary {0: 117, 1: 658, 2: 2057, 3: 4596, 4: 7475} {0: 64, 1: 7094, 2: 188230, 3: 319327, 4: 203668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!