|
Left Crispr |
Right Crispr |
| Crispr ID |
990877291 |
990877299 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:60500023-60500045
|
5:60500076-60500098
|
| Sequence |
CCCAGGCTGGGTGTGGTGGCTCA |
AAACAGGATAACTTGAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 1, 2: 79, 3: 1816, 4: 17351} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|