ID: 990877291_990877299

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 990877291 990877299
Species Human (GRCh38) Human (GRCh38)
Location 5:60500023-60500045 5:60500076-60500098
Sequence CCCAGGCTGGGTGTGGTGGCTCA AAACAGGATAACTTGAGCCCAGG
Strand - +
Off-target summary {0: 117, 1: 658, 2: 2057, 3: 4596, 4: 7475} {0: 1, 1: 1, 2: 79, 3: 1816, 4: 17351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!