ID: 990897594_990897598

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 990897594 990897598
Species Human (GRCh38) Human (GRCh38)
Location 5:60715768-60715790 5:60715788-60715810
Sequence CCAAGCTCAAGCATCCCAGGTTG TTGGCTTCAGACTGCTATGCTGG
Strand - +
Off-target summary {0: 38, 1: 117, 2: 267, 3: 420, 4: 672} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!