ID: 990905177_990905182

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 990905177 990905182
Species Human (GRCh38) Human (GRCh38)
Location 5:60795614-60795636 5:60795650-60795672
Sequence CCATCCACCAGGGCTGAATGCCG GCCACTGACTTCCAACCCTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 40, 2: 90, 3: 107, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!