ID: 990905505_990905514

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 990905505 990905514
Species Human (GRCh38) Human (GRCh38)
Location 5:60798415-60798437 5:60798448-60798470
Sequence CCTCCCAATTACCTTGATACTAC TTAACTTGCTGAGGGTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140} {0: 1, 1: 0, 2: 0, 3: 18, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!