ID: 990905507_990905515

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 990905507 990905515
Species Human (GRCh38) Human (GRCh38)
Location 5:60798419-60798441 5:60798451-60798473
Sequence CCAATTACCTTGATACTACAGAA ACTTGCTGAGGGTGGAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133} {0: 1, 1: 1, 2: 4, 3: 69, 4: 886}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!