ID: 990905508_990905510

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 990905508 990905510
Species Human (GRCh38) Human (GRCh38)
Location 5:60798426-60798448 5:60798440-60798462
Sequence CCTTGATACTACAGAAGCTTTTT AAGCTTTTTTAACTTGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 284} {0: 1, 1: 0, 2: 1, 3: 36, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!