|
Left Crispr |
Right Crispr |
| Crispr ID |
990921592 |
990921596 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:60974121-60974143
|
5:60974159-60974181
|
| Sequence |
CCACTCTCAGTCCAGGTGGGCAC |
CAGTGCTGCTAGATTAAAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 29, 3: 192, 4: 854} |
{0: 1, 1: 2, 2: 35, 3: 167, 4: 429} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|