ID: 990977029_990977030

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 990977029 990977030
Species Human (GRCh38) Human (GRCh38)
Location 5:61569351-61569373 5:61569389-61569411
Sequence CCTGAGCGCTCAGCACTCTGGGA CAGCCACCCTGCCCAGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 68, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!