ID: 990984082_990984084

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 990984082 990984084
Species Human (GRCh38) Human (GRCh38)
Location 5:61626034-61626056 5:61626058-61626080
Sequence CCTGAGGGGCCGTGGTCGCTGCA TTTGTCCGAGACCCCTAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!