ID: 991013804_991013809

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 991013804 991013809
Species Human (GRCh38) Human (GRCh38)
Location 5:61910890-61910912 5:61910929-61910951
Sequence CCCCATAAGAGTCCAAGGGCTGT AGTTATCTGCAGAAGATAGCAGG
Strand - +
Off-target summary No data {0: 7, 1: 195, 2: 193, 3: 120, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!