ID: 991074707_991074710

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 991074707 991074710
Species Human (GRCh38) Human (GRCh38)
Location 5:62522178-62522200 5:62522218-62522240
Sequence CCAACTTCAAGATCAGCATTTTG GCGGACACTAAAAAGCTGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!