ID: 991093934_991093941

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 991093934 991093941
Species Human (GRCh38) Human (GRCh38)
Location 5:62719686-62719708 5:62719734-62719756
Sequence CCTCGGGGGCCTGGCGTGCCTTC CTGTCTGTGCAGCAGCAGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!